| Internal ID | 17655845 | Source Database | TransTermHP TERM 388 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 388
|
| Sequence |
CGGGCCCGCCTCAGCGCGGGCCCG Look for more occurrences |
| Start | 1681028 |
| End | 1681051 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGCCCATCATACAA(5' tail) CGGGCCCGC(5' stem) GCTGAG(loop) GCGGGCCCG(3' stem) TTGGCGGTTCGCAGG(3' tail). Confidence: 91. overlap 1681025 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|