Internal ID | 17655235 | Source Database | TransTermHP TERM 1061 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1061
|
Sequence |
GCCCTCGGCACATGCCGGGGGC Look for more occurrences |
Start | 4227374 |
End | 4227395 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGAGCCAAATTCAAA(5' tail) GCCCTCGGC(5' stem) ACAT(loop) GCCGGGGGC(3' stem) TTTTTCGTTATCGGG(3' tail). Confidence: 100. opp_overlap 4227374 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|