| Internal ID | 17655170 | Source Database | TransTermHP TERM 960 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 960
|
| Sequence |
GGGCGGACACCTTCGGGTGGCCGCCC Look for more occurrences |
| Start | 3919697 |
| End | 3919722 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCGCAACGAAAAA(5' tail) GGGCGGCCACC(5' stem) CGAA(loop) GGTGTCCGCCC(3' stem) TTTTTCGTCGCCAGC(3' tail). Confidence: 100. opp_overlap 3919697 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|