| Internal ID | 17655168 | Source Database | TransTermHP TERM 957 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 957
|
| Sequence |
CGGCCGGGGCCTCGGCCCCGGCCC Look for more occurrences |
| Start | 3918509 |
| End | 3918532 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAGCCTGTAGGACCC(5' tail) CGGCCGGGGC(5' stem) CTCG(loop) GCCCCGGCCC(3' stem) TTTCCCGGAAGCCCC(3' tail). Confidence: 90. opp_overlap 3918491, overlap 3918510 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|