Internal ID | 17655012 | Source Database | TransTermHP TERM 686 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 686
|
Sequence |
GGCGCGGCGCGAGCCGCGCC Look for more occurrences |
Start | 2702157 |
End | 2702176 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGGGAACAGGCAAGA(5' tail) GGCGCGGC(5' stem) GCGA(loop) GCCGCGCC(3' stem) TTTTTTCGTCTGGCC(3' tail). Confidence: 100. opp_overlap 2702155 2702157 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|