Internal ID | 17654880 | Source Database | TransTermHP TERM 481 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 481
|
Sequence |
GGGCGTCCTTCCGGACGCCC Look for more occurrences |
Start | 1687809 |
End | 1687828 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PACS2 chromosome, whole genome shotgun sequence, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGGGGGATAAAAGAA(5' tail) GGGCGTCC(5' stem) GGAA(loop) GGACGCCC(3' stem) TGAAGATGATCATGG(3' tail). Confidence: 100. overlap 1687806 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|