Internal ID | 17654389 | Source Database | TransTermHP TERM 1280 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1280
|
Sequence |
GCCCTGTCTCGCGACGGGGC Look for more occurrences |
Start | 6038174 |
End | 6038193 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 2192 supercont1.1 genomic scaffold, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TAGCTCGCTGAAAAA(5' tail) GCCCTGTC(5' stem) TCGC(loop) GACGGGGC(3' stem) TTTTTTGTTTCTGCG(3' tail). Confidence: 100. opp_overlap 6038174 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|