| Internal ID | 16841351 | Source Database | A cross-reference and link to the record at is not available yet. |
| Feature Type | Inverted repeat |
| Name |
Palindrome
|
| Sequence |
GCCCTGTTCCACGTGGAACAGGGC Look for more occurrences |
| Start | 124229 |
| End | 124252 |
| Strand | + |
| Genomic Context | Located within gene [PCH03S_RS22365] |
| Replicon | Pseudomonas chlororaphis subsp. aureofaciens NBRC 3521, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | Software: Palindrome (EMBOSS 6.4.0.0) |
|
EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A
Trends Genet. 2000 Jun;16(6):276-7
PubMed ID: 10827456
|