Internal ID | 1572016 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
Feature Type | motif |
Name |
PvdS binding site
|
Sequence |
TAATTATTTGCCGTTGTTATCCGT Look for more occurrences |
Start | 2721664 |
End | 2721687 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000314
direct assay evidence used in manual assertion
qRT-PCR [RNA],Motif-discovery,DNA-array expression analysis
|
Additional Comments |
The effect of zinc limitation on the transcriptome of Pseudomonas protegens Pf-5.
Lim CK, Hassan KA, Penesyan A, Loper JE, Paulsen IT
Environ. Microbiol. 2013 Mar;15(3):702-15
PubMed ID: 22900619
|