Internal ID | 1571769 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
Feature Type | motif |
Name |
IscR binding site
|
Sequence |
AAACCCGAGGTTTTCGCTCGGGTAAA Look for more occurrences |
Start | 2860361 |
End | 2860386 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000314
direct assay evidence used in manual assertion
DNA-array expression analysis,Consensus search
|
Additional Comments |
The IHF regulon of exponentially growing Pseudomonas putida cells.
Silva-Rocha R, Chavarría M, Kleijn RJ, Sauer U, de Lorenzo V
Environ. Microbiol. 2013 Jan;15(1):49-63
PubMed ID: 22510163
|