| Internal ID | 1571713 |
| Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
AlgR binding site
|
| Sequence |
GCCTGCCGTTCATCCTCCTT Look for more occurrences |
| Start | 3889859 |
| End | 3889878 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,Site directed mutagenesis,EMSA,Consensus search
|
| Additional Comments |
|
Pseudomonas aeruginosa AlgR represses the Rhl quorum-sensing system in a biofilm-specific manner.
Morici LA, Carterson AJ, Wagner VE, Frisk A, Schurr JR, Höner zu Bentrup K, Hassett DJ, Iglewski BH, Sauer K, Schurr MJ
J. Bacteriol. 2007 Nov;189(21):7752-64
PubMed ID: 17766417
|