| Internal ID | 1571708 |
| Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
Vfr binding site
|
| Sequence |
AATTGTGATGAAGTTGGCATGA Look for more occurrences |
| Start | 3722909 |
| End | 3722930 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
EMSA,PSSM site search
|
| Additional Comments |
|
Characterization of DNA-binding specificity and analysis of binding sites of the Pseudomonas aeruginosa global regulator, Vfr, a homologue of the Escherichia coli cAMP receptor protein.
Kanack KJ, Runyen-Janecky LJ, Ferrell EP, Suh SJ, West SE
Microbiology (Reading, Engl.) 2006 Dec;152(Pt 12):3485-96
PubMed ID: 17159200
|