Internal ID | 1571706 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
Feature Type | motif |
Name |
Vfr binding site
|
Sequence |
GGCAAATGGCTAGGTCACAGAA Look for more occurrences |
Start | 5680790 |
End | 5680811 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000314
direct assay evidence used in manual assertion
EMSA,PSSM site search
|
Additional Comments |
Characterization of DNA-binding specificity and analysis of binding sites of the Pseudomonas aeruginosa global regulator, Vfr, a homologue of the Escherichia coli cAMP receptor protein.
Kanack KJ, Runyen-Janecky LJ, Ferrell EP, Suh SJ, West SE
Microbiology (Reading, Engl.) 2006 Dec;152(Pt 12):3485-96
PubMed ID: 17159200
|