| Internal ID | 1571044 | Source Database | CollecTF A cross-reference and link to the record at CollecTF is not available yet. (CollecTF website) |
| Feature Type | motif |
| Name |
LasR binding site
|
| Sequence |
ACCTGCCCGGAAGGGCAGGT Look for more occurrences |
| Start | 2068996 |
| End | 2069015 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000314
direct assay evidence used in manual assertion
Beta-gal reporter assay,Site directed mutagenesis,Visual sequence inspection
|
| Additional Comments |
|
Promoter specificity elements in Pseudomonas aeruginosa quorum-sensing-controlled genes.
Whiteley M, Greenberg EP
J. Bacteriol. 2001 Oct;183(19):5529-34
PubMed ID: 11544214
|