Internal ID | 11708891 | Source Database | A cross-reference and link to the record at is not available yet. |
Feature Type | Inverted repeat |
Name |
Palindrome
|
Sequence |
AAAGGCGCCCATGGGCGCCTTT Look for more occurrences |
Start | 2766077 |
End | 2766098 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWH055 adTzt-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | Software: Palindrome (EMBOSS 6.4.0.0) |
EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A
Trends Genet. 2000 Jun;16(6):276-7
PubMed ID: 10827456
|