Internal ID | 10717775 | Source Database | A cross-reference and link to the record at is not available yet. |
Feature Type | Inverted repeat |
Name |
Palindrome
|
Sequence |
GGAAGCCTGCGCAGGCTTCC Look for more occurrences |
Start | 1302922 |
End | 1302941 |
Strand | + |
Genomic Context | Located within gene [Q013_03462] |
Replicon | Pseudomonas aeruginosa X13273 genomic scaffold adgeE-supercont1.2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | Software: Palindrome (EMBOSS 6.4.0.0) |
EMBOSS: the European Molecular Biology Open Software Suite.
Rice P, Longden I, Bleasby A
Trends Genet. 2000 Jun;16(6):276-7
PubMed ID: 10827456
|