Internal ID | 17656352 | Source Database | TransTermHP TERM 1181 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1181
|
Sequence |
GCCCACCTTCGCAGGTGGGC Look for more occurrences |
Start | 5086890 |
End | 5086909 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TACAGAAACGAAAAA(5' tail) GCCCACCT(5' stem) TCGC(loop) AGGTGGGC(3' stem) TTTTTCGTCTTGAAT(3' tail). Confidence: 100. opp_overlap 5086890, overlap 5086881 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|