Internal ID | 17656154 | Source Database | TransTermHP TERM 856 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 856
|
Sequence |
GCCCCTGCCGCGGATACGGCAGGGGC Look for more occurrences |
Start | 3802506 |
End | 3802531 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCGGAAAGCAGAAA(5' tail) GCCCCTGCCG(5' stem) CGGATA(loop) CGGCAGGGGC(3' stem) TTTCTTCGCCTGGCG(3' tail). Confidence: 100. opp_overlap 3802506 3802502 3802499 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|